El descubrimiento del SARS-CoV-2

Todo empezó con un grupo de pacientes con neumonía atípica en Wuhan. Un grupo de científicos no sabían que, al analizarlos, encontrarían un virus capaz de poner el mundo patas arriba. Se ha hablado mucho sobre exosomas y fragmentos sueltos de ARN que no indican la presencia de un virus completo. Vamos a diseccionar el artículo científico que detalla los pasos desde la recogida de muestras de pacientes hasta la identificación del SARS-CoV-2, llamado en su momento 2019-nCoV.

La historia comienza con las muestras obtenidas del tracto respiratorio de pacientes con neumonía en Wuhan. El primer paso era identificar el patógeno. Para ello, se utilizó un kit que es capaz de detectar la presencia de 22 virus y bacterias, incluyendo especies de gripe y coronavirus. Las muestras dieron negativo para todas estas especies. Se descartó de esta forma que la neumonía estuviera producida por ninguno de esos patógenos. Por lo tanto, se puso en marcha la identificación del virus o bacteria que había hecho enfermar a estas personas. Para ello, lo primero fue conocer la secuencia genética de lo que había en las muestras, en busca del genoma del patógeno en cuestión.

Radiografía torácica de un paciente de Wuhan con COVID-19. Na Zhu y colaboradores, 2020.

Este tipo de experimentos se llevan a cabo en dos fases. En la primera, se realizan PCRs que amplifican de forma indiscriminada pequeños fragmentos de ADN (o ARN, previa conversión a ADN) de la muestra en cuestión. La segunda fase consiste en conocer la secuencia genética de estos fragmentos mediante avanzadas técnicas de secuenciación masiva. La secuencia de cada fragmento se denomina “lectura” o “read“, en inglés. Los investigadores que descubrieron el SARS-CoV-2 obtuvieron más de 20.000 lecturas, semejantes en un 85% al genoma de un coronavirus de murciélago, lo que les dio la pista del tipo de patógeno que estaba causando las neumonías.

Estas 20.000 lecturas en sí mismas no constituyen el genoma del SARS-CoV-2, sino fragmentos de él desordenados. Fue necesario utilizar programas bioinformáticos que son capaces de ordenar estas lecturas, obteniéndose así el genoma completo (casi 30.000 nucleótidos) en un proceso llamado ensamblado genético. No puede hacerse de otra forma, dado que las PCRs tienen limitaciones de tamaño. No es posible amplificar mediante dicha técnica un fragmento muy grande de ADN. Precisamente se utiliza este sistema basado en lecturas en estos casos, donde se desconoce el tamaño del genoma que se está estudiando. En el Proyecto Genoma Humano, obviamente, no se amplificaron los 46 cromosomas que lo componen con con 46 PCRs, sino que se hicieron millones de lecturas y, mediante programas bioinformáticos, se compuso la secuencia de todo el genoma.

Identificación del genoma de SARS-CoV-2. Educaina, 2020.

Pero los investigadores no se quedaron ahí. Se centrifugaron las muestras de pacientes enfermos para eliminar restos de células y quedarse con la parte que contenía virus. Esta parte se usó para infectar células habituales en el estudio de coronavirus, como son las Vero E6 y Huh-7. Se ha dicho que son células enfermas porque provienen de tumores y que pueden no ser ideales. Sin embargo, nada más lejos de la realidad. En investigación se usan, de rutina, células que provienen de tumores porque son “inmortales”, en tanto que se dividen constantemente, algo necesario para hacerlas crecer en placas. De hecho, como confirman los investigadores del artículo, comprobaron específicamente que estaban libres de patógenos, como es habitual.

Observaron muerte celular sólo en las céulas infectadas con el virus proveniente de pacientes. Comprobaron por PCR que se estaban expresando los genes del nuevo coronavirus dentro de dichas células. Pero, además, mediante microscopio electrónico pudieron ver partículas virales formadas sólo en las células infectadas. Dichas partículas virales eran similares a las de otros coronavirus, y diferentes de exosomas, como se ha sugerido. Esto confirmó, tanto por secuencia genética como por estructura física, que se había descubierto un nuevo coronavirus.

Partículas maduras de SARS-CoV-2 obtenidas tras la purificación y aislamiento. Na Zhu y colaboradores, 2020

Una vez conocida la secuencia, es fácil idear un test PCR que identifique al SARS-CoV-2 en una muestra, bien sea de una persona o de aguas residuales. Basta con elegir zonas específicas de su genoma. Evidentemente, si la infección se ha neutralizado recientemente o el virus se ha ido inactivando por alguna otra razón en el momento de tomar la muestra, aún pueden quedar fragmentos del genoma. Eso propicia que los tests PCR den positivo a una persona que no sufre ya la enfermedad. Esto no quiere decir que los test sean inútiles, ni mucho menos. ThermoFisher, por poner un ejemplo, es uno de los principales proveedores de reactivos de laboratorio y tiene un kit para identificar SARS-CoV-2 de una manera tan específica que distingue dicho virus del SARS-CoV-1 y otros coronavirus similares.

Esta es la historia del descubrimiento del SARS-CoV-2, uno de los virus más famosos de la historia de la humanidad, sin duda. No ajeno a controversias de todo tipo, es incuestionable su existencia, aislamiento en laboratorio, capacidad para producir la enfermedad COVID-19 (cumpliendo los postulados de Koch) y se vuelve cada vez más necesario conseguir una vacuna que traiga normalidad al mundo, inundado de rebrotes.

10 comentarios sobre “El descubrimiento del SARS-CoV-2

  1. Extraordinario artículo, te animo a hacer uno nuevo que podrías titular, algo así como:

    ¿Se puede ver el Coronavirus SARS-CoV-2?

    Bien es cierto que en este artículo ya has mencionado el tema de la microscopia electrónica, pero sería genial ahondar en ello, así como en la nanoscopia óptica.

    Más que nada porque hay bastantes personas que dicen que “necesitan verlo”.

    Pues que mejor que hacer un tema sobre ello.

    Ahí te dejo la sugerencia xD

    Muchas gracias por compartir tu conocimiento.

    Saludos desde Santander.

    Me gusta

    1. Muchas gracias por tus palabras y por la sugerencia. No sé si daría para un artículo completo, la verdad. Los bacteriófagos son más impresionantes vistos por microscopía. Aunque es cierto que se pueden visualizar los coronavirus, no sale rentable demostrarlo de esta forma para detectar si una persona está infectada. Para eso están los métodos más rápidos como la PCR o los tests de anticuerpos. Pese a que haya gente que desconfíe de ellos, son métodos muy sensibles. Un saludo.

      Me gusta

  2. Creo que eres un hallazgo como divulgador. Me encantan tus artículos. Una pregunta cuando dices ‘ThermoFisher, por poner un ejemplo, es uno de los principales proveedores de reactivos de laboratorio y tiene un kit para identificar SARS-CoV-2 de una manera tan específica que distingue dicho virus del SARS-CoV-1 y otros coronavirus similares”, Quieres decir que otros test PCR no distinguen entre coronavirus similares? Entonces son posibles los falsos positivos con PCR? Por positivo me refiero a portadores del virus infeccioso o de partes que ya no son infecciosas pero que corresponden inequívocamente al Sars-cov-2. Gracias Javier.

    Me gusta

    1. Muchísimas gracias por tus palabras. Divulgar la ciencia es apasionante. Elegí ThermoFisher por ser un proveedor famoso de reactivos de laboratorio. Los falsos positivos son bastante poco frecuentes, puede deberse a una contaminación de la muestra o de algún reactivo. Los test en general son muy específicos y sirven para amplificar fragmentos exclusivos del genoma del SARS-CoV-2. Bien elegidos, los cebadores (u oligonucleótidos) que se utilizan, sólo hibridan en estas regiones dando un fragmento de ADN de un tamaño que permite distinguir si el resultado positivo es tal, minimizando mucho el riesgo de error. En general, se utilizan 2 o 3 zonas del genoma a amplificar por PCR, y sólo te dan un “positivo” si todas han salido bien.
      Como bien dices, cuando ya estás eliminando el virus aún puede salir positiva la PCR si quedan restos de genoma. Pero la ventana de tiempo en la que esto sucede en nuestro organismo no suele ir más allá de unos días. Por eso se deben repetir a los 14 días las PCR y confirmar el resultado.

      Me gusta

  3. Hola Javier en este articulo (muy didactico) indicas:

    “Fue necesario utilizar programas bioinformáticos que son capaces de ordenar estas lecturas, obteniéndose así el genoma completo (casi 30.000 nucleótidos) en un proceso llamado ensamblado genético. No puede hacerse de otra forma, dado que las PCRs tienen limitaciones de tamaño. No es posible amplificar mediante dicha técnica un fragmento muy grande de ADN. ”

    podrias por favor aclarar si estos programas bioinformaticos simplemento ordenan lecturas/fragmentos de ADN en el orden que creemos correcto de manera que nos da la secuencia de ADN o si tambien estos programas bioinformaticos de alguna manera rellenan los huecos de en aquellas secuencias donde no se han obtenido todas las lecturas necesarias para formar una secuencia completa.

    un cordial saludo

    Me gusta

    1. Saludos. Los programas no rellenan, eso no tendría sentido, el ordenador no puede suponer nucleótidos. Imagina que cada lectura es como un ficha de dominó. El final de la primera lectura debe coincidir con el principio de la siguiente de una forma significativa. Pongo un ejemplo un poco burdo:
      – Lectura 1: AAATTTGG
      – Lectura 2: ATTTGGGA
      – Lectura 3: TGGGAACCC
      – Lectura 4: ACCCTATATA
      – Secuencia completa: AAATTTGGGTGGGAACCCTATATA

      ¿Ves el patrón? El programa compara el principio y el final de cada lectura para darle un sentido. Aquí tienes otro ejemplo más realista de cómo se “alinean” las lecturas (o reads, en inglés) para conocer la secuencia completa: https://contig.files.wordpress.com/2010/02/alignment1.jpg
      ¡Un saludo!

      Me gusta

  4. Gracias por el artículo!
    Como se explicaría el positivo en aguas residuales de Barcelona de marzo de 2019?
    Como se explica que 2 o más tests hechos con un mismo individuo casi siempre resulte un resultado diferente?
    Afirmas la diferencia entre en virus y exosomas, podrías profundizar un poco más en sus diferencias?

    Muchísimas gracias!

    Me gusta

  5. Buenos días Javier,
    He leído atentamente el artículo al que hace mención sobre el estudio realizado en el que descubren el SARS-Cov-2 y en el mismo dice:

    ” Although our study does not fulfill Koch’s postulates, …” (que traducido al español:)

    “Aunque nuestro estudio no cumple los postulados de Koch, ….”.

    Estoy seguro que usted también lo ha podido leer en el documento en la sección final “Discussion”, por eso creo que para dar una mayor credibilidad debería de corregir su post e indicar correctamente la información extraída.

    Por lo demás muy interesante, a tener muy en cuenta, aunque no comparto del todo la conclusión final. Gracias por compartir sus conocimientos.
    Un saludo!

    Me gusta

  6. Estimado Javier, en relación a la cuestión del aislamiento del sars cov-2 en este artículo se plantean varias cuestiones que ninguna persona con la que lo he compartido ha conseguido aclararme.

    https://off-guardian.org/2020/06/27/covid19-pcr-tests-are-scientifically-meaningless/

    Lo que a mí más me llama la atención entre otras cosas es lo siguiente:

    _Todos los equipos científicos con los que han contactado reconocen que en sus micrografías no muestran el virus purificado. Y son estudios que han sido publicados y algunos de ellos han sido utilizados por divulgadores, agencias de verificación, científicos… como prueba de su aislamiento.

    _Cuando se ponen en contacto con el doctor Calisher, un virólogo y profesor en la Universidad Estatal de Colorado (esto lo he mirado) les dice que él no ha encontrado todavía un paper en el que el SARS Cov-2 haya sido aislado y debidamente purificado (en las referencias pone que ese mensaje lo recibieron en mayo).

    _Preguntan a los principales laboratorios y virólogos alemanes que defienden la validez de los pcr cómo saben si esa secuencia genética pertenece a un nuevo virus especificio si las supuestas particulas del SARS Cov-2 nunca han sido purificadas. No obtienen respuesta.

    _Con la mediación de un abogado consiguen contactar con el Hospital Charité, lugar de trabajo del doctor Drosten (el primero en desarrollar los pcr para covid-19), y reconocen que no utilizaron particulas purificadas.

    ¿Qué informaciones refuntan estos puntos que el artículo plantea?

    Un saludo y gracias por tu tiempo.

    Me gusta

Responder

Introduce tus datos o haz clic en un icono para iniciar sesión:

Logo de WordPress.com

Estás comentando usando tu cuenta de WordPress.com. Cerrar sesión /  Cambiar )

Google photo

Estás comentando usando tu cuenta de Google. Cerrar sesión /  Cambiar )

Imagen de Twitter

Estás comentando usando tu cuenta de Twitter. Cerrar sesión /  Cambiar )

Foto de Facebook

Estás comentando usando tu cuenta de Facebook. Cerrar sesión /  Cambiar )

Conectando a %s

A %d blogueros les gusta esto: